epithelial cell line hela ccl 2 Search Results


99
ATCC human cervical epithelium hela cell line
Human Cervical Epithelium Hela Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/HeLa/pm40543506-308-0-6
Average 99 stars, based on 1 article reviews
human cervical epithelium hela cell line - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp cdh1 hs01023894 m1
Gene Exp Cdh1 Hs01023894 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/Gene+Exp%2E+CDH1%2C+Hs01023894_m1/pmc07493029__jmcb___2019___0055_r3_supplementary_material_finalized_version_mjaa005-47-25--1
Average 99 stars, based on 1 article reviews
gene exp cdh1 hs01023894 m1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
ATCC hela cells
Hela Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/HeLa/pm36821445-230-0-6
Average 99 stars, based on 1 article reviews
hela cells - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
JCRB Cell Bank hela cells
(A) Cell-surface expression of CEACAM5 (CEA) and NIP-modified molecules on <t>HeLa,</t> HeLa CEA and <t>HeLa</t> <t>cells</t> labeled with 2.5 µg/mL of the hapten (HeLa NIP ). (B) FACS analysis of CD69 expression by Jurkat EGFP , Jurkatα CEA-CIR-EGFP and Jurkatα NIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HeLa CEA or HeLa NIP ) for 16 hours.
Hela Cells, supplied by JCRB Cell Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/hela+cells/pmc02747005-94-7-23
Average 90 stars, based on 1 article reviews
hela cells - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
ATCC hela 229 epithelial cells
(A) Cell-surface expression of CEACAM5 (CEA) and NIP-modified molecules on <t>HeLa,</t> HeLa CEA and <t>HeLa</t> <t>cells</t> labeled with 2.5 µg/mL of the hapten (HeLa NIP ). (B) FACS analysis of CD69 expression by Jurkat EGFP , Jurkatα CEA-CIR-EGFP and Jurkatα NIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HeLa CEA or HeLa NIP ) for 16 hours.
Hela 229 Epithelial Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/HeLa+229/pmc03431695-104-0-6
Average 96 stars, based on 1 article reviews
hela 229 epithelial cells - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

hela  (ATCC)
99
ATCC hela
Pro-inflammatory cytokines TNF and TRAIL increase the production and release of reactive oxygen and nitrogen species (ROS/RNS) in cells expressing HPV oncogenes. The levels of ROS and RNS in the absence or presence of pro-inflammatory cytokines alone (2 nM TNF or 50 ng/mL TRAIL) or in combination (2 nM TNF and 50 ng/mL TRAIL) were determined in cultures of PHKs ( A ), PHKs transduced with HPV16 oncogenes ( B ), and <t>in</t> <t>cervical</t> cancer-derived cell lines SiHa (positive for HPV16) ( C ) and <t>HeLa</t> (positive for <t>HPV18)</t> ( D ) using the OxiSelect™ In Vitro ROS/RNS Assay Kit (Cell Biolabs, Inc.), according to the manufacturer’s instructions. The results presented are representative of three independent experiments. Solid lines represent statistical differences between intracellular samples and dashed lines between supernatant samples as determined by Student’s t -test ( p -value ≤ 0.05).
Hela, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/Hs888Lu%3B+Lung+Fibroblast%3B+Human/pmc06337392-215-8-10
Average 99 stars, based on 1 article reviews
hela - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
ATCC cell lines mda mb 231 atcc htb 26 hela atcc ccl 2 oligonucleotides tub f tggactctgttcgctcaggt yale school
Key Resources Table
Cell Lines Mda Mb 231 Atcc Htb 26 Hela Atcc Ccl 2 Oligonucleotides Tub F Tggactctgttcgctcaggt Yale School, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/MDA-MB-231/pmc05777153-517-176-179
Average 99 stars, based on 1 article reviews
cell lines mda mb 231 atcc htb 26 hela atcc ccl 2 oligonucleotides tub f tggactctgttcgctcaggt yale school - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

97
ATCC nd hela cells
Key Resources Table
Nd Hela Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/Ca+Ski/pm15037417-79-7-10
Average 97 stars, based on 1 article reviews
nd hela cells - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

Image Search Results


(A) Cell-surface expression of CEACAM5 (CEA) and NIP-modified molecules on HeLa, HeLa CEA and HeLa cells labeled with 2.5 µg/mL of the hapten (HeLa NIP ). (B) FACS analysis of CD69 expression by Jurkat EGFP , Jurkatα CEA-CIR-EGFP and Jurkatα NIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HeLa CEA or HeLa NIP ) for 16 hours.

Journal: PLoS ONE

Article Title: Lymphocyte Display: A Novel Antibody Selection Platform Based on T Cell Activation

doi: 10.1371/journal.pone.0007174

Figure Lengend Snippet: (A) Cell-surface expression of CEACAM5 (CEA) and NIP-modified molecules on HeLa, HeLa CEA and HeLa cells labeled with 2.5 µg/mL of the hapten (HeLa NIP ). (B) FACS analysis of CD69 expression by Jurkat EGFP , Jurkatα CEA-CIR-EGFP and Jurkatα NIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HeLa CEA or HeLa NIP ) for 16 hours.

Article Snippet: 293T cells (human embryo kidney epithelia; CRL-11268), HeLa cells (human cervix carcinoma; CCL-2), HT-1080 cells (human fibrosarcoma; CCL-121), MKN45 cells (human stomach adenocarcinoma; JCRB-0254), and MDA-MB231 cells (human breast adenocarcinoma; HTB-26) were grown in DMEM supplemented with 10% (vol/vol) heat-inactivated FCS, (Invitrogen Life Technologies, Gaithersburg, MD, USA), referred as to DMEM complete medium (DCM).

Techniques: Expressing, Modification, Labeling

(A) Cell-surface expression of CEACAM5 (CEA) on HeLa, HT1080, MDA-MB-231 and MKN45 cells. (B) FACS analysis of CD69 expression by Jurkat, Jurkatα CEA-CIR-EGFP and Jurkatα NIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HT1080, MDA-MB-231 or MKN45) for 16 hours.

Journal: PLoS ONE

Article Title: Lymphocyte Display: A Novel Antibody Selection Platform Based on T Cell Activation

doi: 10.1371/journal.pone.0007174

Figure Lengend Snippet: (A) Cell-surface expression of CEACAM5 (CEA) on HeLa, HT1080, MDA-MB-231 and MKN45 cells. (B) FACS analysis of CD69 expression by Jurkat, Jurkatα CEA-CIR-EGFP and Jurkatα NIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HT1080, MDA-MB-231 or MKN45) for 16 hours.

Article Snippet: 293T cells (human embryo kidney epithelia; CRL-11268), HeLa cells (human cervix carcinoma; CCL-2), HT-1080 cells (human fibrosarcoma; CCL-121), MKN45 cells (human stomach adenocarcinoma; JCRB-0254), and MDA-MB231 cells (human breast adenocarcinoma; HTB-26) were grown in DMEM supplemented with 10% (vol/vol) heat-inactivated FCS, (Invitrogen Life Technologies, Gaithersburg, MD, USA), referred as to DMEM complete medium (DCM).

Techniques: Expressing

Pro-inflammatory cytokines TNF and TRAIL increase the production and release of reactive oxygen and nitrogen species (ROS/RNS) in cells expressing HPV oncogenes. The levels of ROS and RNS in the absence or presence of pro-inflammatory cytokines alone (2 nM TNF or 50 ng/mL TRAIL) or in combination (2 nM TNF and 50 ng/mL TRAIL) were determined in cultures of PHKs ( A ), PHKs transduced with HPV16 oncogenes ( B ), and in cervical cancer-derived cell lines SiHa (positive for HPV16) ( C ) and HeLa (positive for HPV18) ( D ) using the OxiSelect™ In Vitro ROS/RNS Assay Kit (Cell Biolabs, Inc.), according to the manufacturer’s instructions. The results presented are representative of three independent experiments. Solid lines represent statistical differences between intracellular samples and dashed lines between supernatant samples as determined by Student’s t -test ( p -value ≤ 0.05).

Journal: International Journal of Molecular Sciences

Article Title: HPV-Mediated Resistance to TNF and TRAIL Is Characterized by Global Alterations in Apoptosis Regulatory Factors, Dysregulation of Death Receptors, and Induction of ROS/RNS

doi: 10.3390/ijms20010198

Figure Lengend Snippet: Pro-inflammatory cytokines TNF and TRAIL increase the production and release of reactive oxygen and nitrogen species (ROS/RNS) in cells expressing HPV oncogenes. The levels of ROS and RNS in the absence or presence of pro-inflammatory cytokines alone (2 nM TNF or 50 ng/mL TRAIL) or in combination (2 nM TNF and 50 ng/mL TRAIL) were determined in cultures of PHKs ( A ), PHKs transduced with HPV16 oncogenes ( B ), and in cervical cancer-derived cell lines SiHa (positive for HPV16) ( C ) and HeLa (positive for HPV18) ( D ) using the OxiSelect™ In Vitro ROS/RNS Assay Kit (Cell Biolabs, Inc.), according to the manufacturer’s instructions. The results presented are representative of three independent experiments. Solid lines represent statistical differences between intracellular samples and dashed lines between supernatant samples as determined by Student’s t -test ( p -value ≤ 0.05).

Article Snippet: Cervical cancer-derived cell lines SiHa (HPV16, ATCC #HTB-35), HeLa (HPV18, ATCC #CCL-2) and C33 (HPV-negative, ATCC #HTB-31) were cultured in MEM (Invitrogen, Carlsbad, CA, USA) supplemented with 10% BCS (Cultilab, Campinas, SP, Brazil) and maintained at 37 °C and 5% CO 2 .

Techniques: Expressing, Transduction, Derivative Assay, In Vitro

Key Resources Table

Journal: Cell chemical biology

Article Title: Lessons in PROTAC design from selective degradation with a promiscuous warhead

doi: 10.1016/j.chembiol.2017.09.010

Figure Lengend Snippet: Key Resources Table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies c-Abl SantaCruz 23 Arg SantaCruz 81154 Axl Cell Signaling 4939 p-AKT Cell Signaling 4060 CDK4 Cell Signaling 12790 DDR1 SantaCruz 532 EphA2 Cell Signaling 6997 FLAG M2 Sigma F1804 GAPDH Cell Signaling 2118 MerTK Cell Signaling 4319 p38alpha Cell Signaling 9218 p38alpha Cell Signaling 9228 p38delta Cell Signaling 2308 RIPK2 Cell Signaling 4142 c-MET Cell Signaling 8198 SLK Cell Signaling 41255 Src Cell Signaling 2123 CUL2 Invitrogen 700179 VHL Cell Signaling 68547 Tubulin Sigma T9026 HRP linked Mouse IgG GE Life Sciences NA931 HRP Linked Rabbit IgG GE Life Sciences NA934 Chemicals, Peptides, and Recombinant Proteins Cycloheximide Sigma C104450 Epoxomicin Crews laboratory Glutathione Sepharose 4B beads GE Life Sciences 17075601 Ni-NTA agarose QIAGEN 30250 Alpha Glutathione Donor beads PerkinElmer 6765300 Anti-6xHis AlphaLISA Acceptor beads PerkinElmer AL128C Recombinant Human Gas6 Protein R&D Systems 885-GSB-0503 SYPRO Orange Protein Gel Stain Sigma S5692 TRIzol Reagent ThermoFisher 15596018 MAPKAPK2 Protein, Inactive ThermoFisher PV3316 MAPKAPK2 Protein, Inactive ThermoFisher PV3317 Critical Commercial Assays Z′-LYTE Kinase Assay Kit – Ser/Thr 4 Peptide ThermoFisher PV3177 ThermoFisher Experimental Models: Cell Lines MDA-MB-231 ATCC HTB-26 HeLa ATCC CCL-2 Oligonucleotides Tub_F: TGGACTCTGTTCGCTCAGGT Yale School of Medicine N/A Tub_R: TGCCTCCTTCCGTACCACAT Yale School of Medicine N/A p38α_F: TCGCATGAATGATGGACTGAAAT Yale School of Medicine N/A p38α_R: CCCGAGCGTTACCAGAACC Yale School of Medicine N/A Software and Algorithms Image Lab 6.0 BioRad N/A Graphpad Prism N/A Pymol Schrodinger LLC Equipment Synergy 2 microplate reader Biotek Open in a separate window Key Resources Table

Techniques: Recombinant, Staining, Kinase Assay, Software