|
ATCC
human cervical epithelium hela cell line Human Cervical Epithelium Hela Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/HeLa/pm40543506-308-0-6 Average 99 stars, based on 1 article reviews
human cervical epithelium hela cell line - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp cdh1 hs01023894 m1 Gene Exp Cdh1 Hs01023894 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/Gene+Exp%2E+CDH1%2C+Hs01023894_m1/pmc07493029__jmcb___2019___0055_r3_supplementary_material_finalized_version_mjaa005-47-25--1 Average 99 stars, based on 1 article reviews
gene exp cdh1 hs01023894 m1 - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
ATCC
hela cells Hela Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/HeLa/pm36821445-230-0-6 Average 99 stars, based on 1 article reviews
hela cells - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
JCRB Cell Bank
hela cells ![]() Hela Cells, supplied by JCRB Cell Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/hela+cells/pmc02747005-94-7-23 Average 90 stars, based on 1 article reviews
hela cells - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
ATCC
hela 229 epithelial cells ![]() Hela 229 Epithelial Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/HeLa+229/pmc03431695-104-0-6 Average 96 stars, based on 1 article reviews
hela 229 epithelial cells - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
ATCC
hela ![]() Hela, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/Hs888Lu%3B+Lung+Fibroblast%3B+Human/pmc06337392-215-8-10 Average 99 stars, based on 1 article reviews
hela - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
ATCC
cell lines mda mb 231 atcc htb 26 hela atcc ccl 2 oligonucleotides tub f tggactctgttcgctcaggt yale school ![]() Cell Lines Mda Mb 231 Atcc Htb 26 Hela Atcc Ccl 2 Oligonucleotides Tub F Tggactctgttcgctcaggt Yale School, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/MDA-MB-231/pmc05777153-517-176-179 Average 99 stars, based on 1 article reviews
cell lines mda mb 231 atcc htb 26 hela atcc ccl 2 oligonucleotides tub f tggactctgttcgctcaggt yale school - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
ATCC
nd hela cells ![]() Nd Hela Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/epithelial+cell+line+hela+ccl+2/Ca+Ski/pm15037417-79-7-10 Average 97 stars, based on 1 article reviews
nd hela cells - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLoS ONE
Article Title: Lymphocyte Display: A Novel Antibody Selection Platform Based on T Cell Activation
doi: 10.1371/journal.pone.0007174
Figure Lengend Snippet: (A) Cell-surface expression of CEACAM5 (CEA) and NIP-modified molecules on HeLa, HeLa CEA and HeLa cells labeled with 2.5 µg/mL of the hapten (HeLa NIP ). (B) FACS analysis of CD69 expression by Jurkat EGFP , Jurkatα CEA-CIR-EGFP and Jurkatα NIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HeLa CEA or HeLa NIP ) for 16 hours.
Article Snippet: 293T cells (human embryo kidney epithelia; CRL-11268),
Techniques: Expressing, Modification, Labeling
Journal: PLoS ONE
Article Title: Lymphocyte Display: A Novel Antibody Selection Platform Based on T Cell Activation
doi: 10.1371/journal.pone.0007174
Figure Lengend Snippet: (A) Cell-surface expression of CEACAM5 (CEA) on HeLa, HT1080, MDA-MB-231 and MKN45 cells. (B) FACS analysis of CD69 expression by Jurkat, Jurkatα CEA-CIR-EGFP and Jurkatα NIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HT1080, MDA-MB-231 or MKN45) for 16 hours.
Article Snippet: 293T cells (human embryo kidney epithelia; CRL-11268),
Techniques: Expressing
Journal: International Journal of Molecular Sciences
Article Title: HPV-Mediated Resistance to TNF and TRAIL Is Characterized by Global Alterations in Apoptosis Regulatory Factors, Dysregulation of Death Receptors, and Induction of ROS/RNS
doi: 10.3390/ijms20010198
Figure Lengend Snippet: Pro-inflammatory cytokines TNF and TRAIL increase the production and release of reactive oxygen and nitrogen species (ROS/RNS) in cells expressing HPV oncogenes. The levels of ROS and RNS in the absence or presence of pro-inflammatory cytokines alone (2 nM TNF or 50 ng/mL TRAIL) or in combination (2 nM TNF and 50 ng/mL TRAIL) were determined in cultures of PHKs ( A ), PHKs transduced with HPV16 oncogenes ( B ), and in cervical cancer-derived cell lines SiHa (positive for HPV16) ( C ) and HeLa (positive for HPV18) ( D ) using the OxiSelect™ In Vitro ROS/RNS Assay Kit (Cell Biolabs, Inc.), according to the manufacturer’s instructions. The results presented are representative of three independent experiments. Solid lines represent statistical differences between intracellular samples and dashed lines between supernatant samples as determined by Student’s t -test ( p -value ≤ 0.05).
Article Snippet: Cervical cancer-derived cell lines SiHa (HPV16, ATCC #HTB-35),
Techniques: Expressing, Transduction, Derivative Assay, In Vitro
Journal: Cell chemical biology
Article Title: Lessons in PROTAC design from selective degradation with a promiscuous warhead
doi: 10.1016/j.chembiol.2017.09.010
Figure Lengend Snippet: Key Resources Table
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies c-Abl SantaCruz 23 Arg SantaCruz 81154 Axl Cell Signaling 4939 p-AKT Cell Signaling 4060 CDK4 Cell Signaling 12790 DDR1 SantaCruz 532 EphA2 Cell Signaling 6997 FLAG M2 Sigma F1804 GAPDH Cell Signaling 2118 MerTK Cell Signaling 4319 p38alpha Cell Signaling 9218 p38alpha Cell Signaling 9228 p38delta Cell Signaling 2308 RIPK2 Cell Signaling 4142 c-MET Cell Signaling 8198 SLK Cell Signaling 41255 Src Cell Signaling 2123 CUL2 Invitrogen 700179 VHL Cell Signaling 68547 Tubulin Sigma T9026 HRP linked Mouse IgG GE Life Sciences NA931 HRP Linked Rabbit IgG GE Life Sciences NA934 Chemicals, Peptides, and Recombinant Proteins Cycloheximide Sigma C104450 Epoxomicin Crews laboratory Glutathione Sepharose 4B beads GE Life Sciences 17075601 Ni-NTA agarose QIAGEN 30250 Alpha Glutathione Donor beads PerkinElmer 6765300 Anti-6xHis AlphaLISA Acceptor beads PerkinElmer AL128C Recombinant Human Gas6 Protein R&D Systems 885-GSB-0503 SYPRO Orange Protein Gel Stain Sigma S5692 TRIzol Reagent ThermoFisher 15596018 MAPKAPK2 Protein, Inactive ThermoFisher PV3316 MAPKAPK2 Protein, Inactive ThermoFisher PV3317 Critical Commercial Assays Z′-LYTE Kinase Assay Kit – Ser/Thr 4 Peptide ThermoFisher PV3177 ThermoFisher Experimental Models:
Techniques: Recombinant, Staining, Kinase Assay, Software